Stem-loop sequence bdi-MIR5185k

AccessionMI0025315 (change log)
DescriptionBrachypodium distachyon miR5185k stem-loop
Gene family MIPF0001246; MIR5185
Literature search

1 open access papers mention bdi-MIR5185k
(1 sentences)

Stem-loop
   gaucc   a       c            u                     a    g 
5'      cgc aaagucc gcuucuaguuca uuuucaaaucuucuauucaaa uuuu u
        ||| ||||||| |||||||||||| ||||||||||||||||||||| ||||  
3'      gcg uuucagg cgaagaucaagu aagaguuuagaggauaaguuu aaga u
   -----   c       a            u                     -    c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
5: 24868302-24868411 [-]
intergenic
Database links

Mature sequence bdi-miR5185k-5p

Accession MIMAT0030125
Sequence

20 - 

uucuaguucauuuuucaaauc

 - 40

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR5185k-3p

Accession MIMAT0030126
Sequence

78 - 

uuugagaauugaacuagaagc

 - 98

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).