Stem-loop sequence bdi-MIR7707

AccessionMI0025318 (change log)
DescriptionBrachypodium distachyon miR7707 stem-loop
Stem-loop
   ---                                              a      c     ccaacggcggccgcggaggagcggcgaggaaucggagcacggaggcggcgcggaaccuagccaggacgcggcgcuugga 
5'    caaugggaccguucagccauacaucgaucgaagcagagacaacgua uacgag agugg                                                                               g
      |||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||                                                                                
3'    guuacucuggcaagucgguauguagcuaguuucguuucuguugcau augcuc ucacc                                                                               a
   auc                                              c      a     auauuaccucauccaucaguuaguggaagaucuuacagccgcgcucgagaucgaaccaagucggaacgggaccguucgg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
4: 44574033-44574313 [+]
intergenic
Database links

Mature sequence bdi-miR7707-5p

Accession MIMAT0030131
Sequence

11 - 

guucagccauacaucgaucgaagc

 - 34

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7707-3p

Accession MIMAT0030132
Sequence

247 - 

uuugaucgauguauggcugaacgg

 - 270

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).