Stem-loop sequence bdi-MIR7708a

AccessionMI0025319 (change log)
DescriptionBrachypodium distachyon miR7708a stem-loop
Gene family MIPF0001801; MIR7708
Stem-loop
   ca         au c            cc                     a  -       -        cca   -a                uug         cccucaggauggcgcuuuuugcuugggaggacgacgguuuugcaccauuuuuuucucuaauugaaaauuuggccccaaaagacgguacguaagugucaac 
5'   gaacacacc  c gauuguguuuuu  ucaguaccguuacaauuuugu ga cauuugc acagcacg   gcu  gucuaaaauggaaagu   acuuuuuuc                                                                                                    u
     |||||||||  | ||||||||||||  ||||||||||||||||||||| || ||||||| ||||||||   |||  ||||||||||||||||   |||||||||                                                                                                     
3'   uuugugugg  g cuaacgcagaaa  agucaugguaauguuaaaaca cu guaaacg uguugugu   uga  cggauuuugcuuuuca   ugaaaaagg                                                                                                    u
   gc         cg c            ca                     -  a       g        -aa   ac                caa         uguuaugggggcuggacuuaaaauuuggauacuaaaacaccugacaacacuaaguugaacuccgauuuacgacuuguuaaaaaauuaguuuauuacaggu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
4: 31535894-31536302 [+]
intergenic
Clustered miRNAs
< 10kb from bdi-MIR7708a
bdi-MIR7708a4: 31535894-31536302 [+]
bdi-MIR50584: 31543610-31543707 [+]
Database links

Mature sequence bdi-miR7708a-5p

Accession MIMAT0030133
Sequence

22 - 

guuuuuccucaguaccguuacaau

 - 45

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7708a-3p

Accession MIMAT0030134
Sequence

367 - 

uguaaugguacugaacaaagacgc

 - 390

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).