Stem-loop sequence bdi-MIR7709

AccessionMI0025320 (change log)
DescriptionBrachypodium distachyon miR7709 stem-loop
Stem-loop
   -cugccca   g                            u     a     agaccaac               aaa    c  u    u      c   a      c  ccuacacccuua   u  -        g  a         u       g     a        a       u c          -gc     u 
5'         aug cauuaaaguaugacuaggcacacguccu gucuc ucaug        gccuugaugugacga   agcu ca cuuu aggugu ggc aggaca ac            uug uc uguggguc ug cccucgugu gcuuagu ccagg cauacccu uuggucg g gggccuuggu   ucacg g
           ||| |||||||||||||||||||||||||||| ||||| |||||        |||||||||||||||   |||| || |||| |||||| ||| |||||| ||            ||| || |||||||| || ||||||||| ||||||| ||||| |||||||| ||||||| | ||||||||||   ||||| u
3'         uac guaguuucaugcugauccgugugcggga cggag agugc        cggggcuacgcugcu   ucga gu gaaa uccgua ccg uccugu ug            aac ag acacccgg ac gggagugcg cggaucg gguuc guguggga gaccggc c cccggaaccg   agugu c
   uaaaaaaa   g                            -     g     -------a               ---    c  u    c      c   g      c  --------caaa   c  c        a  c         c       a     g        a       c a          gaa     u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
3: 18724294-18724682 [-]
intergenic
Clustered miRNAs
< 10kb from bdi-MIR7709
bdi-MIR77093: 18724294-18724682 [-]
bdi-MIR94903: 18715092-18715183 [-]
Database links

Mature sequence bdi-miR7709-5p

Accession MIMAT0030135
Sequence

15 - 

uaaaguaugacuaggcacacg

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7709-3p

Accession MIMAT0030136
Sequence

356 - 

ugugccuagucguacuuugau

 - 376

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).