Stem-loop sequence bdi-MIR7710

AccessionMI0025321 (change log)
DescriptionBrachypodium distachyon miR7710 stem-loop
Stem-loop
   --                c  auc          c       a       c       c      a  c              acc       c   - uagggu 
5'   ugguccuucgcuacua ag   gugaugucaa uuugaaa auuauuc gagcaca cuagcg cg ugguaccuaccaua   ucuucau uag c      a
     |||||||||||||||| ||   |||||||||| ||||||| ||||||| ||||||| |||||| || ||||||||||||||   ||||||| ||| |      u
3'   accaggaagcgaugau uc   cacuguaguu aaacuuu uaguaag cucgugu gaucgu gc gcuauggaugguau   agaagua auc g      a
   ca                a  aaa          a       g       a       a      a  a              ---       -   a ugagaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
4: 46018159-46018364 [+]
intergenic
Database links

Mature sequence bdi-miR7710-5p

Accession MIMAT0030137
Sequence

12 - 

uacuacagaucgugaugucaacuu

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7710-3p

Accession MIMAT0030138
Sequence

172 - 

auugaugucacaaacuauaguagc

 - 195

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).