Stem-loop sequence bdi-MIR7711

AccessionMI0025322 (change log)
DescriptionBrachypodium distachyon miR7711 stem-loop
Stem-loop
   g         a c      a                              c   a              u      a      u            a caa     c a                   ---aa            u                            cu   g  a                   c     -g         c      ac   a        aaggcauagcguaagggaugucuuauuacgaauaa 
5'  gauaauaga a auacuu gccucuuugacaaucuugaugauagaauuu uaa uuagaagccauaag gaaauc acucau cugaauuuuaug c   gauaa g uaaugaaucucuuuguuuu     augucuaagaug uuuugcauuaccaagucaaauucugcaa  auc ca cacaagcuaagaaguuacc uuaag  uauugugaa uugcuc  ugg ucuucuaa                                   u
    ||||||||| | |||||| |||||||||||||||||||||||||||||| ||| |||||||||||||| |||||| |||||| |||||||||||| |   ||||| | |||||||||||||||||||     |||||||||||| ||||||||||||||||||||||||||||  ||| || ||||||||||||||||||| |||||  ||||||||| ||||||  ||| ||||||||                                   u
3'  cuauuguuu u uaugaa cggagaaauuguuagaacuacuauuuuaaa guu aaucuucgguauuc cuuuag ugagua gacuuaaaauac g   cuauu c auuacuuagagagacaaaa     ugcggauucuac agaacguaaugguuuaguuuaagacguu  uag gu guguucgauucuuuaaugg aauuc  guaacauuu aacgag  acc aggagauu                                   g
   -         c u      c                              c   c              u      c      u            c auc     a g                   aauua            c                            ac   g  a                   u     aa         c      cu   g        uucgguuaacacaaguuguucuuuaaaguuuuacc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
3: 4809448-4809995 [-]
intergenic
Database links

Mature sequence bdi-miR7711-5p.1

Accession MIMAT0030139
Sequence

15 - 

uacuuagccucuuugacaaucuug

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7711-5p.2

Accession MIMAT0030140
Sequence

39 - 

augauagaauuucuaaauuagaag

 - 62

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7711-5p.3

Accession MIMAT0030141
Sequence

63 - 

ccauaagugaaaucaacucauucu

 - 86

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7711-5p.4

Accession MIMAT0030142
Sequence

84 - 

ucugaauuuuaugaccaagauaac

 - 107

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7711-3p.4

Accession MIMAT0030143
Sequence

445 - 

uauccuagccauaaaauucaguau

 - 468

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7711-3p.3

Accession MIMAT0030144
Sequence

466 - 

uaugagucgauuucucuuauggcu

 - 489

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7711-3p.1

Accession MIMAT0030145
Sequence

514 - 

agauuguuaaagaggccaaguauu

 - 537

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).