Stem-loop sequence bdi-MIR7712

AccessionMI0025323 (change log)
DescriptionBrachypodium distachyon miR7712 stem-loop
Stem-loop
   -gua      u   gag  c            --cc   auaa u  c     g    a    cuauugguuuu     -  --g   uaacuagccauauuuuggcuaaauacauuuugaucucagauauuaccaaccaacuacaauguaaauuacuagucuaaugacaaagaguuaccacauugaaaacugaucucacucaugaaguuccagugagaguuccaguaauagaguuaucguacuauccacaaguaguuaucagcuaguaaacugugaguuaucgggcucuau 
5'     cuacuu uua   cu ugaaguuaccac    aca    g ga uuauc ggcu uuca           agugc ua   acc                                                                                                                                                                                                            u
       |||||| |||   || ||||||||||||    |||    | || ||||| |||| ||||           ||||| ||   |||                                                                                                                                                                                                            c
3'     gaugaa ggu   ga auuucaauggug    ugu    c cu aauag ccga aagu           ucaug au   ugg                                                                                                                                                                                                            a
   aaug      c   --a  -            uuau   auaa -  c     a    g    ----------u     u  aua   uguagaguaguguaucaauggguugaaaacucaaugucaauggugcuaccgugaauucucucaauggaucgauaaguaccauauaaauaguagcaucguggcuacaucaaacgaucaauauauccaauaucaauggugguaucgugaacaaaucaaugguaccacaaaucuauucugaaacacaauuuuugacuacugaugaau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
4: 33900876-33901442 [-]
intergenic
Database links

Mature sequence bdi-miR7712-5p

Accession MIMAT0030146
Sequence

12 - 

uagagcucugaaguuaccacccac

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7712-3p

Accession MIMAT0030147
Sequence

534 - 

uuauugugguaacuuuaagauggc

 - 557

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).