Stem-loop sequence bdi-MIR7713

AccessionMI0025324 (change log)
DescriptionBrachypodium distachyon miR7713 stem-loop
Stem-loop
   uagcaacc    ag aau     -gaa   -    ca   a ga       ac  aga    aggugccgaugacagcgcagggugaaauggagagcgucgaggcgguggucccaaaacaugcagguaccaugcgcguaggacacuaggacuguccauguggaccauc 
5'         gcgu  g   ugaug    cag cuca  aug g  ggcgaca  au   ggaa                                                                                                          a
           ||||  |   |||||    ||| ||||  ||| |  |||||||  ||   ||||                                                                                                          u
3'         cgcg  c   auuac    guc gagu  uac c  ccguugu  ua   ccuu                                                                                                          c
   uagguaua    aa --g     gacg   a    uc   - ga       ca  gug    aaguagaagauccguuuuccucucaaaguagguugaacguuuuuuuuuagaauaauuaaaccgaguauuucuuuauuuuaaccgguuuuuuguaaugauguuuaca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
1: 72881362-72881695 [-]
intergenic
Database links

Mature sequence bdi-miR7713-5p

Accession MIMAT0030148
Sequence

12 - 

uaggaauugauggaacagcucaca

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7713-3p

Accession MIMAT0030149
Sequence

301 - 

uugagacuggcagcauuagcaagc

 - 324

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).