Stem-loop sequence bdi-MIR7714

AccessionMI0025325 (change log)
DescriptionBrachypodium distachyon miR7714 stem-loop
Stem-loop
   -auuaugu        uu  cg   ca      c    - guu 
5'         gugcuauu  cu  gau  auauua uugu c   g
           ||||||||  ||  |||  |||||| |||| |   g
3'         uacgauga  ga  cua  uauaau aaca g   u
   acgucuuu        gg  ag   ug      c    u auu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
1: 21292473-21292559 [-]
intergenic
Database links

Mature sequence bdi-miR7714-5p

Accession MIMAT0030150
Sequence

12 - 

uauuuucucggaucaauauuacuu

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7714-3p

Accession MIMAT0030151
Sequence

54 - 

cuaauauguaucgaagggaguagc

 - 77

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).