Stem-loop sequence bdi-MIR7715

AccessionMI0025326 (change log)
DescriptionBrachypodium distachyon miR7715 stem-loop
Stem-loop
   ---    c   g       a    a     g                   gac ug guaaaag 
5'    acgg aua aucaaag uggg uuucu aacagccacuuaacucuau   g  g       a
      |||| ||| ||||||| |||| ||||| |||||||||||||||||||   |  |       a
3'    ugcc uau uaguuuc accc aaaga uugucggugaauugagaug   c  u       a
   acc    a   g       c    a     a                   aaa gu auugggg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
3: 36497308-36497435 [+]
intergenic
Database links

Mature sequence bdi-miR7715-5p

Accession MIMAT0030152
Sequence

11 - 

ucaaagaugggauuucugaac

 - 31

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7715-3p

Accession MIMAT0030153
Sequence

97 - 

uaagaaaacccaccuuugaug

 - 117

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).