Stem-loop sequence bdi-MIR7716

AccessionMI0025327 (change log)
DescriptionBrachypodium distachyon miR7716 stem-loop
Stem-loop
   gagac       u          a                      ---g aga            auc       u   ucaaac                   gccuc   -a   au         cc  ag   -                     a            ug           a 
5'      ggauucg gucaguugcu gagaagaacgaaacgaccguca    c   ggaggagguguc   ggagguc uga      aaagagaaauaagguggcg     agg  guc  cucugcuug  ac  aaa uugcaggaagaggaggagaaa uggaggguucuc  gagaagaugag u
        ||||||| |||||||||| ||||||||||||||||||||||    |   ||||||||||||   ||||||| |||      |||||||||||||||||||     |||  |||  |||||||||  ||  ||| ||||||||||||||||||||| ||||||||||||  ||||||||||| g
3'      ccuaagu caguuaauga cucuucuugcuuugcuggcggu    g   ucuccuucgcag   cuuccag acu      uuucucuuuguuccaccgc     ucc  cag  gagacgaac  ug  uuu aacguccuucuccucuuuuuu acuuuccaagag  uucuucuacuc a
   --cua       c          c                      agca cag            ---       c   ----uu                   -----   gg   cg         cu  cu   c                     g            gu           c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
2: 7864984-7865341 [-]
intergenic
Database links

Mature sequence bdi-miR7716-5p

Accession MIMAT0030154
Sequence

15 - 

ucaguugcuagagaagaacgaaac

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7716-3p

Accession MIMAT0030155
Sequence

325 - 

uucguucuucuccaguaauugacc

 - 348

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).