Stem-loop sequence bdi-MIR7717a

AccessionMI0025328 (change log)
DescriptionBrachypodium distachyon miR7717a stem-loop
Gene family MIPF0001715; MIR7717
Stem-loop
   auaacaauuuu   a   aa   -    g u      aa  ua u    ucc   ggau 
5'            uua uuc  uca uuga a ucgugu  au  a gugg   gau    a
              ||| |||  ||| |||| | ||||||  ||  | ||||   |||     
3'            aau aag  agu agcu u agcaua  ua  u uacu   cua    a
   -auuuuauauc   a   --   c    g u      gg  gc u    --u   aaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
1: 28244716-28244829 [-]
intergenic
Database links

Mature sequence bdi-miR7717a-5p

Accession MIMAT0030156
Sequence

21 - 

ucauugagauucguguaaauuaa

 - 43

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7717a-3p

Accession MIMAT0030157
Sequence

76 - 

gauggauacgauugucgacugaga

 - 99

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).