Stem-loop sequence bdi-MIR7718

AccessionMI0025329 (change log)
DescriptionBrachypodium distachyon miR7718 stem-loop
Stem-loop
   --------------  c           g             cau          c     ---u        u       gcaggauuuuaa       c   g       c       a            u      g   uucaaauu              -  ----a    ccugga   a    a           c           a  --   gug        auu           cc       uuucuau          au   c    --ug    a 
5'               ug ugccauuaacu ucauuuauucguc   ggcgauggua gagua    aggauccu agaaguu            uuuaggu aac ugucuuu augcuuu auggcugguauu guaauu aaa        aaaacacgaagcag uc     cuau      auu uucu accguaaguac uucauaguucu uc  aua   gguaggaa   guguuucuaau  uagaauu       uucugguuag  aaa agug    ucua c
                 || ||||||||||| |||||||||||||   |||||||||| |||||    |||||||| |||||||            ||||||| ||| ||||||| ||||||| |||||||||||| |||||| |||        |||||||||||||| ||     ||||      ||| |||| ||||||||||| ||||||||||| ||  |||   ||||||||   |||||||||||  |||||||       ||||||||||  ||| ||||    ||||  
3'               ac acggugguugg aguaaauaagcag   ccgcuaccau uucgu    uucuagga uuuucaa            ggaucua uug acagaaa uacgaaa uaucgaccauaa cauuaa uuu        uuuugugcuucguu ag     gaua      uaa aaga uggcguucaug agguaucgaga ag  uau   ucauccuu   uacagagauua  aucuuaa       aagaucaauc  uuu ucgu    agau u
   uaaccuuucuaaca  a           g             auu          c     cauc        u       ---agaacaaca       u   a       c       c            u      g   uauuucuu              u  caacc    -caaaa   c    c           u           -  aa   aaa        ---           ac       uacaauu          -c   a    uuua    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
1: 40295515-40296069 [+]
intergenic
Database links

Mature sequence bdi-miR7718-5p

Accession MIMAT0030158
Sequence

16 - 

ucauuuauucguccauggcgaugg

 - 39

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7718-3p

Accession MIMAT0030159
Sequence

505 - 

aucgccuuagacgaauaaaugagg

 - 528

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).