Stem-loop sequence bdi-MIR7719

AccessionMI0025330 (change log)
DescriptionBrachypodium distachyon miR7719 stem-loop
Stem-loop
   --    c  c    c       c           c         u  ugau   -ugaa cu   ag    u 
5'   aauu aa aucu cgccaua auguuucuauc caaucauau gc    cuu     g  ugg  ccgg a
     |||| || |||| ||||||| ||||||||||| ||||||||| ||    |||     |  |||  ||||  
3'   uuaa uu uaga gcgguau uacgaagauag guuaguaua cg    gaa     c  auc  gguu u
   ag    a  c    a       a           u         c  ---u   uuaag ag   -a    g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
1: 40655242-40655380 [-]
intergenic
Database links

Mature sequence bdi-miR7719-5p

Accession MIMAT0030160
Sequence

12 - 

uccgccauacauguuucuauc

 - 32

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7719-3p

Accession MIMAT0030161
Sequence

108 - 

uagaagcauauauggcgaaga

 - 128

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).