Stem-loop sequence bdi-MIR5049

AccessionMI0025331 (change log)
DescriptionBrachypodium distachyon miR5049 stem-loop
Literature search

1 open access papers mention bdi-MIR5049
(2 sentences)

Stem-loop
   gaaauuc       c       c             c  agauu 
5'        auguacu cuuccga ccauauuacuugu gc     u
          ||||||| ||||||| ||||||||||||| ||      
3'        uguauga ggaggcu gguauaaugaaca cg     a
   -uuuuuc       a       a             u  acaua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
1: 9873496-9873584 [-]
intergenic
Database links

Mature sequence bdi-miR5049-5p

Accession MIMAT0030162
Sequence

14 - 

uccuuccgacccauauuacuugu

 - 36

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR5049-3p

Accession MIMAT0030163
Sequence

56 - 

caaguaauauggaucggaggaagu

 - 79

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).