Stem-loop sequence bdi-MIR7720

AccessionMI0025332 (change log)
DescriptionBrachypodium distachyon miR7720 stem-loop
Stem-loop
   --gucg      caau     aauu       c g     ----   - -        cuc 
5'       uggggg    uucga    gaucgug g agaag    ccu c agaaacug   g
         ||||||    |||||    ||||||| | |||||    ||| | ||||||||    
3'       aucucc    agguu    uuaguac c uuuuc    gga g ucuuuggc   a
   acgaug      ----     gggu       a a     ccaa   u c        cag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
5: 17999321-17999432 [-]
intergenic
Database links

Mature sequence bdi-miR7720-5p

Accession MIMAT0030164
Sequence

16 - 

ucgaaauugaucgugcggagaagc

 - 39

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7720-3p

Accession MIMAT0030165
Sequence

78 - 

uuuuacacaugauuuggguuggac

 - 101

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).