Stem-loop sequence bdi-MIR7721

AccessionMI0025333 (change log)
DescriptionBrachypodium distachyon miR7721 stem-loop
Stem-loop
   -        a   cg         aa              a  uuacuugguaauacgauguuauugcgacacaaaagagauaucguuguauuuau 
5'  auaaggcc gca  ggauuuuau  cggacuuuggcgaa ca                                                     a
    |||||||| |||  |||||||||  |||||||||||||| ||                                                      
3'  uauucugg cgu  cuuaagaua  guuugaaacugcuu gu                                                     u
   a        a   aa         cg              -  uaauauguuuuuuacauccauauauuuacaauaugauaaauaacucaaaaggu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
4: 34312043-34312234 [-]
intergenic
Database links

Mature sequence bdi-miR7721-5p

Accession MIMAT0030166
Sequence

12 - 

acgggauuuuauaacggacuuugg

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7721-3p

Accession MIMAT0030167
Sequence

159 - 

aaaguuuggcauagaauucaaugc

 - 182

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).