Stem-loop sequence bdi-MIR7717b

AccessionMI0025334 (change log)
DescriptionBrachypodium distachyon miR7717b stem-loop
Gene family MIPF0001715; MIR7717
Stem-loop
   -uuu  -        aa a     g       ac   a   a       ccuaac           ccaucac      ----    -  aaaauuca 
5'     ug cuauuucu  g cgacu agaaaua  uau ucu agucgac      aaccauucgau       ugagau    ucgu gc        u
       || ||||||||  | ||||| |||||||  ||| ||| |||||||      |||||||||||       ||||||    |||| ||        a
3'     ac gauaaaga  c guuga uuuuuau  aua aga ucagcug      uugguaaguua       auucua    agua cg        u
   ccuu  a        gc a     a       ca   a   g       cuagua           -------      aaaa    a  aauacgaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
3: 35252490-35252674 [+]
intergenic
Database links

Mature sequence bdi-miR7717b-5p

Accession MIMAT0030168
Sequence

11 - 

ucuaagacgacugagaaauaacua

 - 34

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7717b-3p

Accession MIMAT0030169
Sequence

151 - 

aacuauuuuuaaguugaccgagaa

 - 174

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).