Stem-loop sequence bdi-MIR7722

AccessionMI0025335 (change log)
DescriptionBrachypodium distachyon miR7722 stem-loop
Stem-loop
   -               c                     u  c   ----c    u 
5'  gucuauuuuccucuc ucccgguacccuucuuccggu uc auc     cggu g
    ||||||||||||||| ||||||||||||||||||||| || |||     ||||  
3'  cagauaaaaggagag agggcuaugggaagaaggccg ag uag     gcca c
   u               u                     c  a   ccgca    c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
1: 52273428-52273534 [-]
intergenic
Database links

Mature sequence bdi-miR7722-5p

Accession MIMAT0030170
Sequence

12 - 

ucuccucccgguacccuucuu

 - 32

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7722-3p

Accession MIMAT0030171
Sequence

77 - 

gaaggguaucgggaugagagg

 - 97

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).