Stem-loop sequence bdi-MIR7723a

AccessionMI0025336 (change log)
DescriptionBrachypodium distachyon miR7723a stem-loop
Gene family MIPF0001739; MIR7723
Stem-loop
   aaa  u     u                       cu c  ucu   a    a   c      c  cu       a        a  c    uc      u   auuauac         u 
5'    gu caauu ugaaacaacuaucuuggccuucu  u ug   gcu gacc aca auugau uc  auuggua ccccaaca uc uuca  uguaua gca       gauagcuag u
      || ||||| |||||||||||||||||||||||  | ||   ||| |||| ||| |||||| ||  ||||||| |||||||| || ||||  |||||| |||       |||||||||  
3'    ca guuga acuuuguugauggaaccgggaga  a ac   cga cugg ugu ugacua ag  uagccgu gggguugu ag aagu  auauau cgu       uuauugguu u
   uuc  c     c                       ac c  uac   c    a   c      a  --       c        a  a    ua      c   -------         u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
1: 55108461-55108695 [-]
intergenic
Clustered miRNAs
< 10kb from bdi-MIR7723a
bdi-MIR7723b1: 55109092-55109290 [-]
bdi-MIR7723a1: 55108461-55108695 [-]
Database links

Mature sequence bdi-miR7723a-5p

Accession MIMAT0030172
Sequence

13 - 

ugaaacaacuaucuuggccuucuc

 - 36

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7723a-3p

Accession MIMAT0030173
Sequence

202 - 

gagggccaagguaguuguuucaca

 - 225

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).