Stem-loop sequence bdi-MIR7724a

AccessionMI0025337 (change log)
DescriptionBrachypodium distachyon miR7724a stem-loop
Gene family MIPF0001802; MIR7724
Stem-loop
   -uc    g  aa         ac   cu           c   a g u   cc          u    a  ------  uu  caa 
5'    ggca ag  ugaacaugu  aug  ggccaacccaa ccc c a ccu  aucggcauga caug ug      ug  cu   a
      |||| ||  |||||||||  |||  ||||||||||| ||| | | |||  |||||||||| |||| ||      ||  ||    
3'    ucgu uu  acuuguaca  uac  ccgguuggguu ggg g u gga  uggucgugcu guac ac      ac  ga   u
   ugu    g  cc         gu   ac           c   a g c   aa          c    c  uaaaug  cg  cua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
1: 56107496-56107662 [-]
intergenic
Database links

Mature sequence bdi-miR7724a-5p

Accession MIMAT0030174
Sequence

12 - 

ugaacauguacaugcuggccaacc

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7724a-3p

Accession MIMAT0030175
Sequence

134 - 

uuggcccacauugacauguucacc

 - 157

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).