Stem-loop sequence bdi-MIR7725a

AccessionMI0025339 (change log)
DescriptionBrachypodium distachyon miR7725a stem-loop
Gene family MIPF0001792; MIR7725
Stem-loop
   --------------------gaaaugaaucuugacgagaucacaucguuugcacacaaaaucu      a       g               -  --c a    a   c        a  ga   u  uu 
5'                                                                uggcga cuaggga augguuuucgcuaug cu   c ccuc uau ugacugaa ua  auu ug  c
                                                                  |||||| ||||||| ||||||||||||||| ||   | |||| ||| |||||||| ||  ||| ||   
3'                                                                accgcu gauccuu uaccaaaagugauac ga   g ggag aua acugauuu au  uag ac  u
   uacuuuacuuagaacugcuuuaguguaacaaacguguguuuuacaacaggacuacgggacggu      c       a               a  aca a    a   a        a  -g   u  cu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
1: 1326421-1326660 [-]
intergenic
Database links

Mature sequence bdi-miR7725a-5p

Accession MIMAT0030178
Sequence

12 - 

ugacgagaucacaucguuugcaca

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7725a-3p

Accession MIMAT0030179
Sequence

206 - 

ugcaaacaaugugauuucgucaag

 - 229

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).