Stem-loop sequence bdi-MIR7725b

AccessionMI0025340 (change log)
DescriptionBrachypodium distachyon miR7725b stem-loop
Gene family MIPF0001792; MIR7725
Stem-loop
   ---a  u      a       g               -   --ca    a            a  ga   u  uu 
5'     uc uggcga cuaggga augguuuucgcuaug cuc    ccuc uauuugacugaa ua  auu ug  c
       || |||||| ||||||| ||||||||||||||| |||    |||| |||||||||||| ||  ||| ||   
3'     gg accgcu gauccuu uaccaaaagugauac gag    ggag auaaacugauuu au  uag ac  u
   ggac  u      c       a               a   caga    a            a  -g   u  cu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
1: 9582818-9582962 [+]
intergenic
Database links

Mature sequence bdi-miR7725b-5p.1

Accession MIMAT0030180
Sequence

11 - 

acuagggagaugguuuucgcu

 - 31

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7725b-5p.2

Accession MIMAT0030181
Sequence

32 - 

augcuccaccucauauuugac

 - 52

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7725b-3p.2

Accession MIMAT0030182
Sequence

90 - 

caaauaagaggagacgagacauag

 - 113

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7725b-3p.1

Accession MIMAT0030183
Sequence

114 - 

ugaaaaccauauuccuagcuc

 - 134

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).