Stem-loop sequence bdi-MIR7729a

AccessionMI0025344 (change log)
DescriptionBrachypodium distachyon miR7729a stem-loop
Gene family MIPF0001721; MIR7729
Stem-loop
   ----   g ucu   g   ----    ag     gua ag         u 
5'     cuc a   acu uuu    ucau  gccau   g  cuaauuuug g
       ||| |   ||| |||    ||||  |||||   |  ||||||||| g
3'     gag u   uga gag    ggug  uggua   c  gguugaaac u
   ggug   g --u   g   guuu    -g     --a ga         g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
1: 19867091-19867180 [+]
intergenic
2: 5641229-5641318 [-]
intergenic
3: 9790212-9790301 [+]
intergenic
3: 26812498-26812587 [+]
intergenic
Database links

Mature sequence bdi-miR7729a-5p

Accession MIMAT0030190
Sequence

11 - 

uguuuucauaggccauguagagc

 - 33

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7729a-3p

Accession MIMAT0030191
Sequence

56 - 

agcaaugguggugguuuggaggag

 - 79

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).