Stem-loop sequence bdi-MIR7729b

AccessionMI0025345 (change log)
DescriptionBrachypodium distachyon miR7729b stem-loop
Gene family MIPF0001721; MIR7729
Stem-loop
   --    g uuu   g   ----    ag     gua ag         u 
5'   ccuc a   acu uuu    ucau  gccau   g  cuaauuuug g
     |||| |   ||| |||    ||||  |||||   |  ||||||||| g
3'   ggag u   uga gag    ggug  uggua   c  gguugaaac u
   gu    g --u   g   guuu    -g     --a ga         g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
2: 5081776-5081865 [-]
intergenic
4: 29752166-29752255 [-]
intergenic
Database links

Mature sequence bdi-miR7729b-5p

Accession MIMAT0030192
Sequence

12 - 

uguuuucauaggccauguagagc

 - 34

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7729b-3p

Accession MIMAT0030193
Sequence

57 - 

agcaaugguggugguuuggaggag

 - 80

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).