Stem-loop sequence bdi-MIR7731

AccessionMI0025347 (change log)
DescriptionBrachypodium distachyon miR7731 stem-loop
Stem-loop
      cuuuc            u   u        a    -----  cg         aaa   a  uu       u     -------cg     agu      auuuu   u        ug   a       u     c               c      ucuc      c      ucc 
5' cug     ccugauuccaaa ucc gagcaaac uaug     ca  cuuguugug   aac au  cauggau cucug         ggaga   ugacag     cuc aaguaugu  auc cuuguuu ucauu agcuucuuagaguac uuugcc    uacaau uugcau   g
   |||     |||||||||||| ||| |||||||| ||||     ||  |||||||||   ||| ||  ||||||| |||||         |||||   ||||||     ||| ||||||||  ||| ||||||| ||||| ||||||||||||||| ||||||    |||||| ||||||    
3' gac     ggacuaagguuu agg cucguuug auac     gu  gaacgacac   uug ua  gugucua gagac         ccucu   acuguc     gag uucauaca  uag gaacaaa aguaa uugaagaaucucaug aaacgg    auguua aacgug   c
      cacua            c   u        g    aagaa  au         cuc   g  gg       c     aaguaaaua     gcu      -caac   u        cg   g       c     u               u      uuac      c      uga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
4: 4382662-4383014 [+]
intergenic
Database links

Mature sequence bdi-miR7731-5p

Accession MIMAT0030196
Sequence

14 - 

uuccaaauuccugagcaaacauau

 - 37

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7731-3p

Accession MIMAT0030197
Sequence

319 - 

agguuugcucuggacuuuggaauc

 - 342

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).