Stem-loop sequence bdi-MIR7732

AccessionMI0025348 (change log)
DescriptionBrachypodium distachyon miR7732 stem-loop
Stem-loop
   ---aca               a        aga   -   uu g   -   -  a 
5'       ugucggguuccucca gaucucgg   cuc gga  c ggc ggc gg a
         ||||||||||||||| ||||||||   ||| |||  | ||| ||| || u
3'       auaguccaaggaggu cuagagcu   gag ccu  g ccg ucg cc u
   ucuuca               g        --a   a   cu a   a   g  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
3: 6980920-6981024 [+]
intergenic
Clustered miRNAs
< 10kb from bdi-MIR7732
bdi-MIR77323: 6980920-6981024 [+]
bdi-MIR77813: 6987696-6987971 [+]
Database links

Mature sequence bdi-miR7732-5p

Accession MIMAT0030198
Sequence

11 - 

uuccuccaagaucucggagacuc

 - 33

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7732-3p

Accession MIMAT0030199
Sequence

74 - 

gaucgagaucguggaggaacc

 - 94

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).