Stem-loop sequence bdi-MIR7733

AccessionMI0025349 (change log)
DescriptionBrachypodium distachyon miR7733 stem-loop
Stem-loop
   ---  u    g          a       ac                                c    u       c      ca   a       -       uc         -gcg   ua                       ccg          c      a  gc    ucua     g   a   a         ----  g    gu 
5'    ug uuca gcuucucgcc uugccaa  cagggcaagcagaagcgcaaacggacgucuaa ucac gcagcag aagcuc  uca ugccucc cccgugc  gcaucuccc    aca  uaugguuuauguguaccauuuuu   augccgcaga gaugau cu  cuug    auggu ccc aca ccuugguca    gu gucg  u
      || |||| |||||||||| |||||||  |||||||||||||||||||||||||||||||| |||| ||||||| ||||||  ||| ||||||| |||||||  |||||||||    |||  |||||||||||||||||||||||   |||||||||| |||||| ||  ||||    ||||| ||| ||| |||||||||    || ||||   
3'    ac aagu cgaagagcgg agcgguu  gucccguucgucuucgcguuugccugcagauu agug cgucguc uucgag  agu gcggagg ggguacg  cguagaggg    ugu  auaccaaguauacaugguaaaag   uacggcguuu cuacua gg  gagc    uaccg ggg ugu ggaaccagu    ua uagc  c
   cag  u    a          a       gc                                c    c       u      ac   a       a       ga         aaua   cc                       -aa          a      c  ua    uagc     a   c   a         aggu  g    ag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
1: 38847604-38848027 [+]
intergenic
Clustered miRNAs
< 10kb from bdi-MIR7733
bdi-MIR77331: 38847604-38848027 [+]
bdi-MIR77791: 38848227-38848545 [+]
Database links

Mature sequence bdi-miR7733-5p

Accession MIMAT0030200
Sequence

11 - 

uucucgccauugccaaaccagggc

 - 34

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7733-3p

Accession MIMAT0030201
Sequence

390 - 

ccugcguuggcgaaggcgagaagc

 - 413

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).