Stem-loop sequence bdi-MIR7734

AccessionMI0025350 (change log)
DescriptionBrachypodium distachyon miR7734 stem-loop
Stem-loop
   -ccu   c   a     c               c           a    aaa        gu         a  a  aaccgaugguuuuugcgggggucaacgccaagguccauggcguuuuuuuuuugugaaaagccaagguccauggggggcccccccccccccccccc 
5'     cua ggc uugaa gugacuggguuaacg cauauggcuug cguu   gaaaaaac  gguaguuuc ug gc                                                                                               c
       ||| ||| ||||| ||||||||||||||| ||||||||||| ||||   ||||||||  ||||||||| || ||                                                                                                
3'     gau ccg aacuu cacugauccaauugc guauaucggac gcaa   cuuuuuug  ucguuaaag ac cg                                                                                               c
   uguu   a   c     a               c           c    ---        ac         c  -  caaccccacaaccucgaguugcggugucugguaccgcaacugggggguuuugcaguuaaaauguggggucuuuucagcuaaggucaaaaaaaacc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
1: 46850031-46850373 [-]
intergenic
Database links

Mature sequence bdi-miR7734-5p

Accession MIMAT0030202
Sequence

12 - 

uugaacgugacuggguuaacg

 - 32

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7734-3p

Accession MIMAT0030203
Sequence

313 - 

uuaaccuagucacauucaacg

 - 333

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).