Stem-loop sequence bdi-MIR7717c

AccessionMI0025351 (change log)
DescriptionBrachypodium distachyon miR7717c stem-loop
Gene family MIPF0001715; MIR7717
Stem-loop
   --uuuggc  uu   -        ug g             ac       ua   aaugauuacaaccuuuugauucaaucaucgagauuguagg 
5'         gg  uug cuauuucu  g cgacugagaaaua  uauuucu  guc                                        u
           ||  ||| ||||||||  | |||||||||||||  |||||||  |||                                        c
3'         cc  ggc gauaaaga  c guugauucuuuau  auaaaga  uag                                        u
   guuuuuaa  cu   a        gu a             ca       gc   cuguuagcaucaguagguuacuuuuagaaagaauagguag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
3: 32702277-32702466 [+]
intergenic
Database links

Mature sequence bdi-miR7717c-5p

Accession MIMAT0030204
Sequence

11 - 

uugcuauuucuugggcgacugaga

 - 34

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7717c-3p

Accession MIMAT0030205
Sequence

156 - 

uuaguugacugagaaauagacggu

 - 179

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).