Stem-loop sequence bdi-MIR7735

AccessionMI0025352 (change log)
DescriptionBrachypodium distachyon miR7735 stem-loop
Stem-loop
   -   aaac        u uc   cu  a  -c        acg  cgugagcgagcucgaugcugcaucuggaccucggaac 
5'  ggu    gucguugu u  cuu  gc cu  ccggcggc   cc                                     c
    |||    |||||||| |  |||  || ||  ||||||||   ||                                      
3'  cua    cagcggcg a  gaa  cg gg  ggccgcug   gg                                     a
   u   guaa        c ga   -c  a  cu        -aa  uccgacgaugcaguuauugcaaaaagaccgaggcugc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
1: 48106343-48106504 [+]
intergenic
Database links

Mature sequence bdi-miR7735-5p

Accession MIMAT0030206
Sequence

12 - 

uuguuuuccuucugcacucccggc

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7735-3p

Accession MIMAT0030207
Sequence

128 - 

ccggucggagccaagagacgcggc

 - 151

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).