Stem-loop sequence bdi-MIR7736

AccessionMI0025353 (change log)
DescriptionBrachypodium distachyon miR7736 stem-loop
Stem-loop
   aagucuaauucuga                  u gg       aaa                        aa    --     ac 
5'               caagucaucuuuacuauc g  augucac   aaucaacauccaaugauaauggac  guca  uccuu  u
                 |||||||||||||||||| |  |||||||   ||||||||||||||||||||||||  ||||  |||||   
3'               guucaguggaaaugguag c  uacagug   uuaguuguagguugcuauuaccug  cagu  aggaa  a
   -----------aca                  u ua       cuc                        aa    gu     cc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
4: 22303221-22303379 [-]
intergenic
Database links

Mature sequence bdi-miR7736-5p

Accession MIMAT0030208
Sequence

24 - 

uuuacuaucugggaugucaca

 - 44

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7736-3p

Accession MIMAT0030209
Sequence

129 - 

ugacauaucugaugguaaagg

 - 149

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).