Stem-loop sequence bdi-MIR7739

AccessionMI0025356 (change log)
DescriptionBrachypodium distachyon miR7739 stem-loop
Stem-loop
   ---    g uuggg     --   g  gaag      g   -   agacugcagcugggguuguugcggagcaaauugaaugggcuguugcugggguugagacgcccaggugccuugcg 
5'    cuga g     acaga  ugc uc    cggacu gau cua                                                                          g
      |||| |     |||||  ||| ||    |||||| ||| |||                                                                          a
3'    gacu u     ugucu  aug ag    gucuga uua ggu                                                                          u
   acg    g ---ga     uu   a  ---a      g   a   ccccauaccgauguugaugguuccgcgaggcaccucgaugauggguccggucuaaggcguauuagucaccuagu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
1: 41016724-41016952 [+]
intergenic
Database links

Mature sequence bdi-miR7739-5p

Accession MIMAT0030214
Sequence

14 - 

agaugcgucgaagcggacuggauc

 - 37

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7739-3p

Accession MIMAT0030215
Sequence

196 - 

uugagucugagaaguauuucug

 - 217

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).