Stem-loop sequence bdi-MIR7740

AccessionMI0025357 (change log)
DescriptionBrachypodium distachyon miR7740 stem-loop
Stem-loop
              a                      g               uu    aac u 
5' auguagugcuc cauucuucauuugaacaaccuc gucucaucguauaau  cuau   g c
   ||||||||||| |||||||||||||||||||||| |||||||||||||||  ||||   |  
3' uacaucacgag guaagaaguaggcuuguuggag cagaguaguauauua  gaua   c a
              c                      a               -u    gaa a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
3: 3759281-3759403 [+]
intergenic
Database links

Mature sequence bdi-miR7740-5p

Accession MIMAT0030216
Sequence

22 - 

uuugaacaaccucggucucau

 - 42

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7740-3p

Accession MIMAT0030217
Sequence

84 - 

gagacagagguuguucggaug

 - 104

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).