Stem-loop sequence bdi-MIR7726b

AccessionMI0025358 (change log)
DescriptionBrachypodium distachyon miR7726b stem-loop
Gene family MIPF0001804; MIR7726
Stem-loop
   --auaacg          u   gac          a   ca       cg      gu                 cuccaa 
5'         aacgguggca auu   uguaauuuug uga  ugacgua  gcggcg  cguaccaucacuaccaa      u
           |||||||||| |||   |||||||||| |||  |||||||  ||||||  |||||||||||||||||      u
3'         uugccaccgu uaa   acauuaaagc acu  acugcau  cguugc  gcaugguaguggugguu      u
   caccccug          c   ---          c   uc       ag      ug                 auauaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
1: 60124988-60125147 [-]
intergenic
Database links

Mature sequence bdi-miR7726b-5p

Accession MIMAT0030218
Sequence

30 - 

uuugaugacaugacguacggcggc

 - 53

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7726b-3p

Accession MIMAT0030219
Sequence

111 - 

ugcgauacgucacuucaccgaaau

 - 134

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).