Stem-loop sequence bdi-MIR7741

AccessionMI0025359 (change log)
DescriptionBrachypodium distachyon miR7741 stem-loop
Stem-loop
   ----------       ua       a ug      c   u                 uccucuauauuc   ---ucu       ugagaucgcaacccugcacuggcc 
5'           agcuaca  auuuuua u  uggaag ucu gaaguuucgcaugcagu            cug      gucaagu                        a
             |||||||  ||||||| |  |||||| ||| |||||||||||||||||            |||      |||||||                         
3'           ucgaugu  uaaaaau a  accuuc aga cuucaagguguacguca            gac      caguuua                        u
   aacggaaccu       cc       g gu      u   c                 ---------cuu   ucuacu       cuacccacuggagcuccaccgucg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
1: 39792972-39793171 [+]
intergenic
Database links

Mature sequence bdi-miR7741-5p.1

Accession MIMAT0030220
Sequence

12 - 

uuuuaauuguggaagcucuug

 - 32

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7741-5p.2

Accession MIMAT0030221
Sequence

28 - 

ucuugaaguuucgcaugcagu

 - 48

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7741-3p.2

Accession MIMAT0030222
Sequence

145 - 

ugcauguggaacuuccagauc

 - 165

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7741-3p.1

Accession MIMAT0030223
Sequence

161 - 

agaucuuccaugaguaaaaau

 - 181

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).