Stem-loop sequence bdi-MIR7742

AccessionMI0025360 (change log)
DescriptionBrachypodium distachyon miR7742 stem-loop
Stem-loop
   ----caau  c   c           auu        a    uuauuccacacuaguagauauuau 
5'         cu ccg uucauucgcuc   cacacagu gaua                        g
           || ||| |||||||||||   |||||||| ||||                         
3'         ga ggc gaguaagugag   guguguca cuau                        c
   acuugcuc  c   u           cuu        c    ugaccuauacgucugauuagguuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
4: 31253366-31253495 [-]
intergenic
Clustered miRNAs
< 10kb from bdi-MIR7742
bdi-MIR77424: 31253366-31253495 [-]
bdi-MIR319a4: 31253293-31253572 [+]
Database links

Mature sequence bdi-miR7742-5p

Accession MIMAT0030224
Sequence

13 - 

ucauucgcucauucacacagu

 - 33

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7742-3p

Accession MIMAT0030225
Sequence

96 - 

uguguguucgagugaaugagu

 - 116

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).