Stem-loop sequence bdi-MIR7745

AccessionMI0025363 (change log)
DescriptionBrachypodium distachyon miR7745 stem-loop
Stem-loop
   --gg   c acaa g        u        g   ugu  cc 
5'     gac c    a uaaggcuu aguaacaa aga   cu  a
       ||| |    | |||||||| |||||||| |||   ||   
3'     cug g    u guucugaa ucauuguu uuu   ga  a
   aaaa   a aaca g        u        g   ugu  ac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
4: 36289096-36289181 [-]
intergenic
Database links

Mature sequence bdi-miR7745-5p

Accession MIMAT0030230
Sequence

12 - 

aguaaggcuuuaguaacaagagau

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7745-3p

Accession MIMAT0030231
Sequence

52 - 

uuguuguuacuuaagucuugguac

 - 75

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).