Stem-loop sequence bdi-MIR7746

AccessionMI0025364 (change log)
DescriptionBrachypodium distachyon miR7746 stem-loop
Stem-loop
   uacaa    --aa     c            c     c  c g          a        u      a   agcauua      cg a       ----c        uc   agaa      ugcuugag            a         ------a    auuccuagggauggaugauucuugugguaccguuuguauagaucaucguggugagaaauaugagauauggacuagaaucccaacagaaguuauucuuug 
5'      gaga    auaga uaagaguuccaa agaag ua u uuuggugaau uguaaauu ucggac uua       gcacau  u uucagag     gguggucu  uuc    gcaguu        gcuuggggcuug ggggcagcu       uguc                                                                                                   g
        ||||    ||||| |||||||||||| ||||| || | |||||||||| |||||||| |||||| |||       ||||||  | |||||||     ||||||||  |||    ||||||        |||||||||||| |||||||||       ||||                                                                                                    
3'      cucu    uaucu auucucaagguu ucuuc au a aaaccacuua acauuuaa agcuug aau       cgugug  g aagucuu     ccacuaga  aag    cguuag        cgaaccccgaac ccccgucga       acgg                                                                                                   u
   --gua    caug     a            a     a  a g          c        u      g   ------g      au a       caagu        ua   ---a      ---uuaaa            -         aaaaaaa    cacuuuaauuaaagucacucaccuaccagucgauguauuucguuuagcgaaagaccucauauagugaacuuagagacuuucguuuaacggaauccuaag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
2: 53185475-53185979 [-]
intergenic
Database links

Mature sequence bdi-miR7746-5p

Accession MIMAT0030232
Sequence

12 - 

auagacuaagaguuccaacagaag

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7746-3p

Accession MIMAT0030233
Sequence

472 - 

uucuauuggaacucuuaaucuaug

 - 495

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).