Stem-loop sequence bdi-MIR7747

AccessionMI0025365 (change log)
DescriptionBrachypodium distachyon miR7747 stem-loop
Stem-loop
   auuaucac        a                   uga        uc          u   a    g    c          a    uuau  c     c       a           ugcguacuguaguuuacucuagaucguguguaucgcagauuuucaugu 
5'         gggaucag uuguuuuguuguaggauga   aguguugu  gccgaucgga ugu uguu uguu uuggacuaug uagu    gu gaaug acuuuug uuuucagauug                                                u
           |||||||| |||||||||||||||||||   ||||||||  |||||||||| ||| |||| |||| |||||||||| ||||    || ||||| ||||||| |||||||||||                                                 
3'         cucuaguc aacaaaacaauauccuacu   ucacagca  cggcuagucu aua acaa acaa agcuugauac guca    ca cuuac ugaaaac aaaagucuaac                                                c
   uaaucauu        a                   ---        ga          u   c    a    c          c    ----  a     a       a           acacaugaugucuaaaagcauaagagagaaaaucuuugagaacuucuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
1: 53276108-53276440 [-]
intergenic
Database links

Mature sequence bdi-miR7747-5p

Accession MIMAT0030234
Sequence

12 - 

aucagauuguuuuguuguaggaug

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7747-3p

Accession MIMAT0030235
Sequence

300 - 

auccuauaacaaaacaaacugauc

 - 323

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).