Stem-loop sequence bdi-MIR7748a

AccessionMI0025366 (change log)
DescriptionBrachypodium distachyon miR7748a stem-loop
Stem-loop
   ----uu   ac   a        c ag                gu        ua                  guauuaauaaauaauuauaugacauagauucauauccauuguauuccuacu 
5'       uuu  ucc uccaacaa a  ggacguguuagcuuuu  uugaccaa  cuuugaucauaaauuacu                                                   c
         |||  ||| |||||||| |  ||||||||||||||||  ||||||||  ||||||||||||||||||                                                   a
3'       aag  agg agguuguu u  uuuguauaaucgaaag  aacugguu  gaaacugguguuuaauga                                                   a
   gaauau   ga   c        a cu                uc        cg                  aguucuuauacacugauugcacuaguuuuaguaucgguauucguuuauaag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
1: 51138442-51138688 [+]
intergenic
Database links

Mature sequence bdi-miR7748a-5p

Accession MIMAT0030236
Sequence

11 - 

auccaacaacaagggacguguuag

 - 34

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7748a-3p

Accession MIMAT0030237
Sequence

212 - 

aauauguuuucuauuguuggacgg

 - 235

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).