Stem-loop sequence bdi-MIR7749

AccessionMI0025367 (change log)
DescriptionBrachypodium distachyon miR7749 stem-loop
Stem-loop
   ---gucac     gagga   a  g c       gag   g  -  -g  -  -    g     g  -  -      ag 
5'         gggcc     ggc uc u gagggcg   auu cg gc  gc cg gcgc cgugu ug cu gcuuuu  c
           |||||     ||| || | |||||||   ||| || ||  || || |||| ||||| || || ||||||   
3'         cccgg     ucg ag g cucucgc   uaa gu cg  cg gc cgcg gcaca gc ga ugagga  a
   agcgagaa     -----   a  g a       ggg   g  a  ag  u  u    a     g  a  a      gc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
5: 16482116-16482261 [-]
intergenic
Database links

Mature sequence bdi-miR7749-5p

Accession MIMAT0030238
Sequence

19 - 

aucgucgagggcggagauugcggc

 - 42

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7749-3p

Accession MIMAT0030239
Sequence

109 - 

uggaaugggcgcucucagggaagc

 - 132

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).