Stem-loop sequence bdi-MIR7750

AccessionMI0025368 (change log)
DescriptionBrachypodium distachyon miR7750 stem-loop
Stem-loop
   -ga   ---aa   a    a                   ca            u  a  c           --------a    u   ua               c     a       uauu      gu         ug    a   -a     uaaa    uuccuaaaa         a     c            c   -----au     ----u        ac 
5'    gga     cuc ucug aucauugccgaccaugcaa  uaguacuauccu gg ga uaauguuauga         agau guu  caugaugccauuuga uugaa cuugaau    gcagua  uacucauuu  guuu ucu  aaaag    guga         cugcugcga uauug uagugaugcaag aac       ggggu     auugcauu  a
      |||     ||| |||| |||||||||||||||||||  |||||||||||| || || |||||||||||         |||| |||  ||||||||||||||| ||||| |||||||    ||||||  |||||||||  |||| |||  |||||    ||||         ||||||||| ||||| |||||||||||| |||       |||||     ||||||||  g
3'    ccu     gag agac uaguaacggcugguacguu  aucaugauagga cc cu auuacaaugcu         uuua caa  guacuacgguaaacu aacuu gaacuua    uguuau  augagugaa  caaa aga  uuuuc    cacu         gacgaugcu guaac aucacuacguuc uug       uccca     uaacguag  u
   auc   gguca   c    a                   ac            -  a  a           guuuuacug    c   gc               c     c       ----      ug         ua    -   aa     ----    -------uc         a     a            u   auccuuu     uaacu        aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
4: 5126959-5127388 [+]
intergenic
Clustered miRNAs
< 10kb from bdi-MIR7750
bdi-MIR77644: 5125732-5125842 [+]
bdi-MIR77504: 5126959-5127388 [+]
Database links

Mature sequence bdi-miR7750-5p

Accession MIMAT0030240
Sequence

11 - 

aucugaaucauugccgaccaugca

 - 34

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7750-3p

Accession MIMAT0030241
Sequence

395 - 

cauggucggcaaugauacagacga

 - 418

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).