Stem-loop sequence bdi-MIR7751

AccessionMI0025369 (change log)
DescriptionBrachypodium distachyon miR7751 stem-loop
Stem-loop
   ---- g au    u        -c   u  aca g   u   u 
5'     c c  gugg ccaucuuc  ucg gg   a cgg agc u
       | |  |||| ||||||||  ||| ||   | ||| ||| u
3'     g g  cgcu gguagagg  ggc cc   u guu ucg c
   uaua g cu    -        uc   -  acg g   u   g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
3: 8931946-8932027 [+]
intergenic
Database links

Mature sequence bdi-miR7751-5p

Accession MIMAT0030242
Sequence

13 - 

aucuuccucguggacaagcgguag

 - 36

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7751-3p

Accession MIMAT0030243
Sequence

46 - 

uuuggugcacccggcuggagaugg

 - 69

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).