Stem-loop sequence bdi-MIR7752

AccessionMI0025370 (change log)
DescriptionBrachypodium distachyon miR7752 stem-loop
Stem-loop
   -        u aa  c      -ca            a  c      u    aaacaag   ugc               a              c c    a     a         g   uuucc         agaaaauggcaugaccauaagacaugggauagcuggaucuacuuaacugguaguacuaguuaacacguccauauuga 
5'  ccacuuua g  ug ucuucc   cugucauuuucc ga uuaugc gacc       ccu   ugacuccaacauucg aacacaugggagcu a ugau uugcu auccaagua ucu     gccucauga                                                                             c
    |||||||| |  || ||||||   |||||||||||| || |||||| ||||       |||   ||||||||||||||| |||||||||||||| | |||| ||||| ||||||||| |||     |||||||||                                                                             a
3'  gguggaau c  ac agaagg   gauaguaaaagg cu aauacg uugg       gga   acugagguuguaagc uuguguacccucga u acua agcgg uagguucau agg     cggaguacu                                                                             u
   a        c gc  a      uug            c  u      -    -------   -ua               c              a a    g     a         g   uaaca         caggggguucacaguacuuuguuacugcgaacguucugcaagaauaccaguacgguaaaagaagagaccaucuaggg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
3: 3518192-3518609 [-]
intergenic
Database links

Mature sequence bdi-miR7752-5p

Accession MIMAT0030244
Sequence

12 - 

augcucuucccacugucauuuucc

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7752-3p

Accession MIMAT0030245
Sequence

384 - 

aaaaugauagguuggaagaacacgc

 - 408

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).