Stem-loop sequence bdi-MIR7753

AccessionMI0025371 (change log)
DescriptionBrachypodium distachyon miR7753 stem-loop
Stem-loop
   au    gu                                      ccucugugccugcaaagucuuccacugcugcuagccccugcaagcuc 
5'   uuuc  accaaaaugcccaugucuucuuccuugcucaucuucuu                                               a
     ||||  ||||||||||||||||||||||||||||||||||||||                                               u
3'   aaag  ugguuuuauggguacagaagagggaacgaguagaggaa                                               c
   --    ac                                      cuagguaggucacugucuccuucuaccggucguacucuccgcucuuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
1: 22204188-22204374 [+]
intergenic
Database links

Mature sequence bdi-miR7753-5p

Accession MIMAT0030246
Sequence

21 - 

augucuucuuccuugcucauc

 - 41

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7753-3p

Accession MIMAT0030247
Sequence

151 - 

ugagcaagggagaagacaugg

 - 171

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).