Stem-loop sequence bdi-MIR7748b

AccessionMI0025372 (change log)
DescriptionBrachypodium distachyon miR7748b stem-loop
Stem-loop
   uc          a   a       -a   gg        gca      c    c        cga        cua       -caa       ac   aaacaaaua    u 
5'   caacaauaug ggc uguuagg  uuc  uugaccaa   uuugac acaa uuacuuua   auguguga   augugau    aaucaua  cau         uccu g
     |||||||||| ||| |||||||  |||  ||||||||   |||||| |||| ||||||||   ||||||||   |||||||    |||||||  |||         |||| a
3'   guuguuauac ccg auaaucu  aag  aacugguu   aaacug uguu aaugagau   uauauauu   uauacug    uuaguau  gua         agga g
   --          c   c       aa   -a        aug      a    u        aac        -aa       uauc       aa   ----auaca    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
3: 16741357-16741575 [-]
intergenic
Clustered miRNAs
< 10kb from bdi-MIR7748b
bdi-MIR7748b3: 16741357-16741575 [-]
bdi-MIR169f3: 16738806-16738956 [+]
Database links

Mature sequence bdi-miR7748b-5p

Accession MIMAT0030248
Sequence

17 - 

auguuaggauucgguugaccaagc

 - 40

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7748b-3p

Accession MIMAT0030249
Sequence

184 - 

uuggucaaagaaaaucuaauacgc

 - 207

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).