Stem-loop sequence bdi-MIR7755

AccessionMI0025374 (change log)
DescriptionBrachypodium distachyon miR7755 stem-loop
Stem-loop
   a   u    g   u        c                 g       a   -------   uc             u     c   a  u  a  a        cucu 
5'  uga auaa aac aacaauuc acacuguaaauugaaua aauguuu cua       gau  gccuuuucaucug gcuag aac gu cc ga cuagaacc    c
    ||| |||| ||| |||||||| ||||||||||||||||| ||||||| |||       |||  ||||||||||||| ||||| ||| || || || ||||||||    a
3'  acu uauu uug uuguuaag uguggcauuuaacuugu uuacaaa gau       cua  uggaaaaguagac cgauc uug ca gg cu gaucuugg    a
   g   u    g   u        a                 a       c   gcaugua   ua             c     u   a  -  a  c        aaac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
2: 22520134-22520346 [-]
intergenic
Database links

Mature sequence bdi-miR7755-5p

Accession MIMAT0030252
Sequence

19 - 

auuccacacuguaaauugaau

 - 39

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7755-3p

Accession MIMAT0030253
Sequence

177 - 

ucaauuuacgguguagaauug

 - 197

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).