Stem-loop sequence bdi-MIR7723b

AccessionMI0025375 (change log)
DescriptionBrachypodium distachyon miR7723b stem-loop
Gene family MIPF0001739; MIR7723
Stem-loop
   -auu   a            u               a   c  caugc    a      cac    au    u   u                 g  a   u 
5'     aag guucuauuuuga acuacuaccuucauc ucu cu     agcu gaccaa   auug  aucc auu guaaccccaacaauucu ua cua u
       ||| |||||||||||| ||||||||||||||| ||| ||     |||| ||||||   ||||  |||| ||| ||||||||||||||||| || |||  
3'     uuc caagguaaaacu ugaugauggaaguag aga ga     ucga uugguu   uaac  uagg uag cauugggguuguuagga gu gau u
   uaac   -            u               a   a  agcua    g      ---    -c    -   c                 a  a   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
1: 55109092-55109290 [-]
intergenic
Clustered miRNAs
< 10kb from bdi-MIR7723b
bdi-MIR7723b1: 55109092-55109290 [-]
bdi-MIR7723a1: 55108461-55108695 [-]
Database links

Mature sequence bdi-miR7723b-5p

Accession MIMAT0030254
Sequence

13 - 

auuuugauacuacuaccuucauca

 - 36

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7723b-3p

Accession MIMAT0030255
Sequence

166 - 

augaagguaguaguuucaaaaugg

 - 189

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).