Stem-loop sequence bdi-MIR7757

AccessionMI0025377 (change log)
DescriptionBrachypodium distachyon miR7757 stem-loop
Gene family MIPF0002033; MIR7757
Stem-loop
   -----------------------------------------------                    aa         a  a          a     aa     c            g       c       c               c        a c       u         u          a     c  u          ---------             a    cuagcuagaacaacaucauauuaagucuuuagucucaaguaaguccggguaggcuagagaugaaauccaauaggagcuuaacguuguuu 
5'                                                uggaucaugcuucuauuuau  gcucauuga gu acucucuccg gcuca  uaggc aauuuuuuguuu ugugaua acaaaac uucagcuacccacuu cauaucaa u aucucuc ugguuuucu gucuuuugga auaua uu gauaugauaa         aagaugagaaggu gauc                                                                                         c
                                                  ||||||||||||||||||||  ||||||||| || |||||||||| |||||  ||||| |||||||||||| ||||||| ||||||| ||||||||||||||| |||||||| | ||||||| ||||||||| |||||||||| ||||| || ||||||||||         ||||||||||||| ||||                                                                                         a
3'                                                acuuaguacgaagauaaaua  cgaguaacu ca ugagagaggc cgagu  auccg uuaaagaacaaa guacuau uguuuug aaguugaugggugaa guauaguu a uagagag auuagaaga uagaagacuu uguau aa uuauacuauu         uucuacucuucca cuag                                                                                         g
   uuauuauguaaaggaacggaagugucagcaguagccacagauaacca                    ca         -  a          c     gc     a            a       u       u               u        c a       u         u          a     c  u          gauugugau             c    uuuugauaaucauuuucucugaacugaauaucuaguaccaaaccguauuagauguucauucguagaaaaugauuguucaacaugugaug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
2: 57745334-57745931 [+]
intergenic
Database links

Mature sequence bdi-miR7757-5p.1

Accession MIMAT0030258
Sequence

80 - 

cacaaaaccuucagcuaccca

 - 100

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7757-5p.2

Accession MIMAT0030259
Sequence

101 - 

cuuccauaucaaaucaucucu

 - 121

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7757-3p.2

Accession MIMAT0030260
Sequence

434 - 

agauaacuugauauguaagug

 - 454

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7757-3p.1

Accession MIMAT0030261
Sequence

455 - 

gguaguugaauguuuuguuua

 - 475

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).